Top » Catalog » SNPs » M111

$18.00

M111
[M111]

M111
hg38 Position: ChrY:19605419..19605420
Ancestral: ins
Derived: del
Reference: Underhill et al. 2001
ISOGG Haplogroup: O1b1a1a1a1a
Comments: G3.19
Forward Primer: M111_F AATCTTCTGCAAAGGGTTCC
Reverse Primer: M111_R CAGCTACAAAACAAAATACTGGAC
Reviews

Customers who bought this product also purchased
M175
M175
M268
M268
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Z24086
Z24086
P331
P331
F145
F145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies