Top » Catalog » SNPs » M95

$19.00

M95
[M95]

M95
hg38 Position: ChrY:19776558..19776558
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: O1b1a1a
Comments: B9.123
Forward Primer: M95_F TACACTTGGGAAGGGAGTGG
Reverse Primer: M95_R AGACAATGAGGGTGGGTGTG
Reviews

Customers who bought this product also purchased
FTB26822
FTB26822
Y241359
Y241359
A26992
A26992
FTD95597
FTD95597
Y186110
Y186110
F15722
F15722
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies