Top » Catalog » SNPs » M95

$18.00

M95
[M95]

M95
hg38 Position: ChrY:19776558..19776558
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: O1b1a1a
Comments: B9.123
Forward Primer: M95_F TACACTTGGGAAGGGAGTGG
Reverse Primer: M95_R AGACAATGAGGGTGGGTGTG
Reviews

Customers who bought this product also purchased
M111
M111
Y26464
Y26464
M1304
M1304
FGC29898
FGC29898
P49
P49
Z23670
Z23670
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x E353
$18.00
Haplogroup Info
Other products
Currencies