Top » Catalog » SNPs » M95

$18.00

M95
[M95]

M95
hg38 Position: ChrY:19776558..19776558
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: O1b1a1a
Comments: B9.123
Forward Primer: M95_F TACACTTGGGAAGGGAGTGG
Reverse Primer: M95_R AGACAATGAGGGTGGGTGTG
Reviews

Customers who bought this product also purchased
F923
F923
L145
L145
L879
L879
AMM406
AMM406
M9
M9
M175
M175
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies