Top » Catalog » SNPs » M95

$18.00

M95
[M95]

M95
hg38 Position: ChrY:19776558..19776558
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: O1b1a1a
Comments: B9.123
Forward Primer: M95_F TACACTTGGGAAGGGAGTGG
Reverse Primer: M95_R AGACAATGAGGGTGGGTGTG
Reviews

Customers who bought this product also purchased
AMM406
AMM406
M9
M9
M175
M175
M268
M268
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Z24086
Z24086
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies