Top » Catalog » SNPs » Y6198

$18.00

Y6198
[Y6198]

Y6198
hg38 Position: ChrY:17366738..17366738
Ancestral: T
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1a~
Comments: Below PF6751 > Y6200 > Y6174
Forward Primer: Y6198_F GGCAAATAGAAACAAATCAGGTAAC
Reverse Primer: Y6198_R AAAGGGTAAGTGTCAGTTTGGC
Reviews

Customers who bought this product also purchased
E1b-Z834 Panel
E1b-Z834 Panel
Y6174
Y6174
M96
M96
Y29430
Y29430
Z834
Z834
PF6751
PF6751
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies