Top » Catalog » SNPs » Y6198

$18.00

Y6198
[Y6198]

Y6198
hg38 Position: ChrY:17366738..17366738
Ancestral: T
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1a~
Comments: Below PF6751 > Y6200 > Y6174
Forward Primer: Y6198_F GGCAAATAGAAACAAATCAGGTAAC
Reverse Primer: Y6198_R AAAGGGTAAGTGTCAGTTTGGC
Reviews

Customers who bought this product also purchased
V22
V22
Y103771
Y103771
CTS4483
CTS4483
Y19896
Y19896
M267
M267
P68
P68
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies