Top » Catalog » SNPs » S24051

$18.00

S24051
[S24051]

S24051
hg38 Position: ChrY:20003460..20003460
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1b1b2a1a1a~
Comments: Below L795.
Forward Primer: S24051_F ATACAATGCAGAAAGTGTTGTGC
Reverse Primer: S24051_R GCATTTCCCTTGTACACATGAC
Reviews

Customers who bought this product also purchased
Y5420
Y5420
P177
P177
L335
L335
Y14899
Y14899
V13
V13
M81
M81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies