Top » Catalog » SNPs » FGC14589

$18.00

FGC14589
[FGC14589]

FGC14589
hg38 Position: ChrY:20494562..20494562
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC14589_F TGGAACTCATTTCTGGGATTC
Reverse Primer: FGC14589_R CTGCAACAAAAACAGTGTCAAG
Reviews

Customers who bought this product also purchased
Y14514
Y14514
Y21874
Y21874
Y16158
Y16158
KMS86
KMS86
Y14414
Y14414
Y14511
Y14511
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies