Top » Catalog » SNPs » M12135

$18.00

M12135
[M12135]

M12135
hg38 Position: ChrY:7816371..7816371
Ancestral: C
Derived: G
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1b1a2a2
Comments: Found in PG1806 Flow sorted chrY Cell line. Aka Y6400
Forward Primer: M12135_F TGACAGAGTCCAGGCAAGAG
Reverse Primer: M12135_R TGGCCACAGGTGATATTGTG
Reviews

Customers who bought this product also purchased
A13597
A13597
R1b-Z2103 Panel
R1b-Z2103 Panel
A366
A366
Z2103
Z2103
CTS9219
CTS9219
Y30217
Y30217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies