Top » Catalog » SNPs » M12135

$18.00

M12135
[M12135]

M12135
hg38 Position: ChrY:7816371..7816371
Ancestral: C
Derived: G
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1b1a2a2
Comments: Found in PG1806 Flow sorted chrY Cell line. Aka Y6400
Forward Primer: M12135_F TGACAGAGTCCAGGCAAGAG
Reverse Primer: M12135_R TGGCCACAGGTGATATTGTG
Reviews

Customers who bought this product also purchased
CTS9219
CTS9219
Y30217
Y30217
Z2106
Z2106
BY3716
BY3716
FGC14589
FGC14589
A13597
A13597
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies