Top » Catalog » SNPs » Y30217

$18.00

Y30217
[Y30217]

Y30217
hg38 Position: ChrY:15207270..15207270
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Downstream A366 > M12135
Forward Primer: Y30217_F TTTGACAAATCCGTCTGTGC
Reverse Primer: Y30217_R AGGAGTGAGGTTCTCCAAAGC
Reviews

Customers who bought this product also purchased
Z2103
Z2103
CTS9219
CTS9219
BY3716
BY3716
Z2106
Z2106
A13597
A13597
FGC14589
FGC14589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies