Top » Catalog » SNPs » Y30217

$18.00

Y30217
[Y30217]

Y30217
hg38 Position: ChrY:15207270..15207270
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Downstream A366 > M12135
Forward Primer: Y30217_F TTTGACAAATCCGTCTGTGC
Reverse Primer: Y30217_R AGGAGTGAGGTTCTCCAAAGC
Reviews

Customers who bought this product also purchased
FGC14589
FGC14589
M12135
M12135
R1b-Z2103 Panel
R1b-Z2103 Panel
A366
A366
Z2103
Z2103
CTS9219
CTS9219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies