Top » Catalog » SNPs » Z25400

$18.00

Z25400
[Z25400]

Z25400
HG19 Position: ChrY:7045582..7045582
Ancestral: G
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: O2a2a1a2a1a3
Comments: under F2309
Forward Primer: Z25400_F GCCCAAGGATCCCATTAC
Reverse Primer: Z25400_R GCAACAACAGTTCCCTCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies