Top » Catalog » SNPs » FGC54214

$17.50

FGC54214
[FGC54214]

FGC54214
HG19 Position: ChrY:9870807..9870807
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC54214_F GGGGCAAAAATGCCAGTTAC
Reverse Primer: FGC54214_R TGAAGCCATCCTCCTCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies