Top » Catalog » SNPs » FGC62344

$18.00

FGC62344
[FGC62344]

FGC62344
HG19 Position: ChrY:11306823..11306823
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC62344vl_F CACTGAGAGAGGGCTTGGA
Reverse Primer: FGC62344vl_R GGTATGGGTTCCGCTCAAAG
Reviews

Customers who bought this product also purchased
FGC62346
FGC62346
FGC54211
FGC54211
FGC63623
FGC63623
FGC62345
FGC62345
FGC62342
FGC62342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies