Top » Catalog » SNPs » FGC62344

$16.00

FGC62344
[FGC62344]

FGC62344
HG19 Position: ChrY:13462499..13462499
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC62344_F CCCCTTCATCTTCGTGTCTC
Reverse Primer: FGC62344_R GGTATGGGTTCCGCTCAAAG
Reviews

Customers who bought this product also purchased
FGC63623
FGC63623
FGC62345
FGC62345
FGC62342
FGC62342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies