Top » Catalog » SNPs » FGC62344

$17.50

FGC62344
[FGC62344]

FGC62344
HG19 Position: ChrY:13462499..13462499
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC62344_F CCCCTTCATCTTCGTGTCTC
Reverse Primer: FGC62344_R GGTATGGGTTCCGCTCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies