Top » Catalog » SNPs » FGC62345

$17.50

FGC62345
[FGC62345]

FGC62345
HG19 Position: ChrY:14221851..14221851
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC62345_F TGAGGCCAGAGGATAGCTTG
Reverse Primer: FGC62345_R CACAAAACAAATTTTGCAAAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies