Top » Catalog » SNPs » FGC54215

$16.00

FGC54215
[FGC54215]

FGC54215
HG19 Position: ChrY:17112017..17112017
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC54215_F GGCACCAAGGTGTAGTTTCTG
Reverse Primer: FGC54215_R TGGGAAATTCATGCTCAAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies