Top » Catalog » SNPs » FGC15760

$18.00

FGC15760
[FGC15760]

FGC15760
hg38 Position: ChrY:15065229..15065229
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858 > Z640 > FGC5230 > FGC5206
Forward Primer: FGC15760_F GACAATATGACTTCCTCTTTTCCTG
Reverse Primer: FGC15760_R GCACATCAAAAAACTTTTCCG
Reviews

Customers who bought this product also purchased
FGC7984
FGC7984
FGC5229
FGC5229
FGC5240
FGC5240
FGC5235
FGC5235
FGC60704
FGC60704
FGC5231
FGC5231
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies