Top » Catalog » SNPs » FGC15760

$17.50

FGC15760
[FGC15760]

FGC15760
HG19 Position: ChrY:17177109..17177109
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858 > Z640 > FGC5230 > FGC5206
Forward Primer: FGC15760_F GACAATATGACTTCCTCTTTTCCTG
Reverse Primer: FGC15760_R GCACATCAAAAAACTTTTCCG
Reviews

Customers who bought this product also purchased
FGC5231
FGC5231
FGC5206
FGC5206
FGC59067
FGC59067
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Z640
Z640
FGC60653
FGC60653
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies