Top » Catalog » SNPs » HU10

$19.00

HU10
[HU10]

HU10
hg38 Position: ChrY:21282051..21282051
Ancestral: G
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream FGC39461 > ZS2066
Forward Primer: HU10_F CAACAAACCTTCCCCAAATG
Reverse Primer: HU10_R ACCCCCAAGGAGAAACAGTC
Reviews

Customers who bought this product also purchased
ZS2074
ZS2074
J1-BY8 Panel
J1-BY8 Panel
Y36187
Y36187
FGC39459
FGC39459
FGC4422
FGC4422
FT274968
FT274968
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies