Top » Catalog » SNPs » HU55

$18.00

HU55
[HU55]

HU55
hg38 Position: ChrY:10061307..10061307
Ancestral: T
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: B
Comments: Downstream FGC53352
Forward Primer: HU55_F ATGCCTATTTTCCAAAAGCCTG
Reverse Primer: HU55_R GGAGTCACTACCTATGTGAGGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies