Top » Catalog » SNPs » CTS7300

$18.00

CTS7300
[CTS7300]

CTS7300
hg38 Position: ChrY:15300234..15300234
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: O2a2b1a2a1a1a (not listed)
Comments: Extracted from 1000 genomes data. Not qualified. Below F152
Forward Primer: CTS7300_F GGGTGCTTTTGAACACTTGG
Reverse Primer: CTS7300_R GGTCAGGCAGATGAAAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies