Top » Catalog » SNPs » Z26015

$18.00

Z26015
[Z26015]

Z26015
hg38 Position: ChrY:6981210..6981210
Ancestral: C
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: O2a2b1a1a6b1b (not listed)
Comments: under Z25610
Forward Primer: Z26015_F GGAATTCCAGGGAAGAGAGG
Reverse Primer: Z26015_R CCTCAATGTGGACAAACACC
Reviews

Customers who bought this product also purchased
Z26010
Z26010
F145
F145
M133
M133
F14289
F14289
F100
F100
O-F100 Panel
O-F100 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies