Top » Catalog » SNPs » YFS552144

$18.00

YFS552144
[YFS552144]

YFS552144
hg38 Position: ChrY:9587698..9587698
Ancestral: G
Derived: A
Reference: Don Glossinger (2017)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: YFS552144_F TGAAAACATTAGGAGAGTAATTTCCAC
Reverse Primer: YFS552144_R TGTGCACTCGAAAAGACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies