Top » Catalog » SNPs » HU141

$19.00

HU141
[HU141]

HU141
hg38 Position: ChrY:12908774..12908774
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: B2a1a1a1a~ (not listed)
Comments: Below BY16067, approx. BY16061
Forward Primer: HU141_F CCAGATCATTTTCACTTTCCAAC
Reverse Primer: HU141_R CTGTACTGGGCTGGTCACG
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies