Top » Catalog » SNPs » FGC42980

$18.00

FGC42980
[FGC42980]

FGC42980
hg38 Position: ChrY:20907412..20907412
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC42980_F TTGGTCCAATAACATAAAAACAGAG
Reverse Primer: FGC42980_R TGCCATCCTTGCTATGTCTG
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
DNA Sample Kit
DNA Sample Kit
FGC42972
FGC42972
FGC42963
FGC42963
FGC42976
FGC42976
FGC42965
FGC42965
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies