Top » Catalog » SNPs » FGC42980

$18.00

FGC42980
[FGC42980]

FGC42980
hg38 Position: ChrY:20907412..20907412
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC42980_F TTGGTCCAATAACATAAAAACAGAG
Reverse Primer: FGC42980_R TGCCATCCTTGCTATGTCTG
Reviews

Customers who bought this product also purchased
FGC65710
FGC65710
FGC65709
FGC65709
FGC60581
FGC60581
FGC60579
FGC60579
FGC60578
FGC60578
FGC60583
FGC60583
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies