Top » Catalog » SNPs » YP613

$18.00

YP613
[YP613]

YP613
hg38 Position: ChrY:13666499..13666499
Ancestral: T
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: Below Z280 > CTS1211 > Y32 > Y2609 > Y2608
Forward Primer: YP613_F CCATCCAAAGAACTCAGATTGC
Reverse Primer: YP613_R GCATGCAACTGTAGTCCCAAC
Reviews

Customers who bought this product also purchased
YP5502
YP5502
R1a-M458 Panel
R1a-M458 Panel
Y2613
Y2613
Z91
Z91
M458
M458
R1a Superclade Panel
R1a Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies