Top » Catalog » SNPs » YP613

$18.00

YP613
[YP613]

YP613
hg38 Position: ChrY:13666499..13666499
Ancestral: T
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: Below Z280 > CTS1211 > Y32 > Y2609 > Y2608
Forward Primer: YP613_F CCATCCAAAGAACTCAGATTGC
Reverse Primer: YP613_R GCATGCAACTGTAGTCCCAAC
Reviews

Customers who bought this product also purchased
YP343
YP343
Y2609
Y2609
YP6098
YP6098
Z92
Z92
YP235
YP235
YP3929
YP3929
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies