Top » Catalog » SNPs » FGC60167

$18.00

FGC60167
[FGC60167]

FGC60167
hg38 Position: ChrY:22312001..22312001
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2017)
ISOGG Haplogroup: J1a
Comments: Below FGC1713 > ZS10657
Forward Primer: FGC60167_F AGAATGCCATATGAAGCCATG
Reverse Primer: FGC60167_R AGTCCTCAAACACACTGGGAC
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
FGC65873
FGC65873
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC65856
FGC65856
ALK443
ALK443
FGC60163
FGC60163
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
$18.00
Haplogroup Info
Other products
Currencies