Top » Catalog » SNPs » FGC60167

$15.00

FGC60167
[FGC60167]

FGC60167
hg38 Position: ChrY:22312001..22312001
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2017)
ISOGG Haplogroup: J1a
Comments: Below FGC1713 > ZS10657
Forward Primer: FGC60167_F AGAATGCCATATGAAGCCATG
Reverse Primer: FGC60167_R AGTCCTCAAACACACTGGGAC
Reviews

Customers who bought this product also purchased
FGC44057
FGC44057
Y67107
Y67107
Y8965
Y8965
AD0000004
AD0000004
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC65856
FGC65856
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies