Top » Catalog » SNPs » FGC60167

$18.00

FGC60167
[FGC60167]

FGC60167
hg38 Position: ChrY:22312001..22312001
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2017)
ISOGG Haplogroup: J1a
Comments: Below FGC1713 > ZS10657
Forward Primer: FGC60167_F AGAATGCCATATGAAGCCATG
Reverse Primer: FGC60167_R AGTCCTCAAACACACTGGGAC
Reviews

Customers who bought this product also purchased
Y67107
Y67107
Y8965
Y8965
AD0000004
AD0000004
FGC44057
FGC44057
ALK443
ALK443
FGC60163
FGC60163
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies