Top » Catalog » SNPs » V1174

$18.00

V1174
[V1174]

V1174
hg38 Position: ChrY:6800596..6800596
Ancestral: C
Derived: A
Reference: Trombetta et al (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Approx. CTS194
Forward Primer: V1174_F GGCACAGGCTATAATGAGTGAG
Reverse Primer: V1174_R ATTTCATGATCGTGGCAGAG
Reviews

Customers who bought this product also purchased
V12
V12
HU159
HU159
CTS8432
CTS8432
Z825
Z825
YSC0000261
YSC0000261
E Superclade Panel
E Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies