Top » Catalog » SNPs » HU170

$18.00

HU170
[HU170]

HU170
hg38 Position: ChrY:13087838..13087838
Ancestral: G
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC1713
Forward Primer: HU170_F CATTCTATTGTTCTTACATACCTTGC
Reverse Primer: HU170_R TGATGCCCTTTGGATTTAGG
Reviews

Customers who bought this product also purchased
Y60236
Y60236
ZS7282
ZS7282
FT77163
FT77163
ZS5804
ZS5804
BY138887
BY138887
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies