Top » Catalog » SNPs » Y12782

$18.00

Y12782
[Y12782]

Y12782
hg38 Position: ChrY:20351596..20351596
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: C2b1a3~ (not listed)
Comments: Below F1918
Forward Primer: Y12782_F ACAATTTTCTCCCATTCTGTAGGTAG
Reverse Primer: Y12782_R TTCCATGCTTAGCACGCC
Reviews

Customers who bought this product also purchased
C Superclade Panel
C Superclade Panel
F3770
F3770
ZQ31
ZQ31
F3918
F3918
BY183180
BY183180
M48
M48
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies