Top » Catalog » SNPs » Y12782

$18.00

Y12782
[Y12782]

Y12782
hg38 Position: ChrY:20351596..20351596
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: C2b1a3~ (not listed)
Comments: Below F1918
Forward Primer: Y12782_F ACAATTTTCTCCCATTCTGTAGGTAG
Reverse Primer: Y12782_R TTCCATGCTTAGCACGCC
Reviews

Customers who bought this product also purchased
BY183180
BY183180
M48
M48
Y4580
Y4580
M532
M532
M401
M401
SK1076
SK1076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
2 x Y78462
2 x A17604
2 x Y28208
$108.00
Haplogroup Info
Other products
Currencies