Top » Catalog » SNPs » Y4541

$18.00

Y4541
[Y4541]

Y4541
hg38 Position: ChrY:8570236..8570236
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: C
Comments: Below M217 > F1918
Forward Primer: Y4541_F CCCAGTGTTCAGTGGGATTG
Reverse Primer: Y4541_R CTGGAGCACAGCCAGACTATC
Reviews

Customers who bought this product also purchased
F3918
F3918
BY183180
BY183180
M48
M48
Y4580
Y4580
SK1076
SK1076
M532
M532
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies