Top » Catalog » SNPs » Y4541

$18.00

Y4541
[Y4541]

Y4541
hg38 Position: ChrY:8570236..8570236
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: C
Comments: Below M217 > F1918
Forward Primer: Y4541_F CCCAGTGTTCAGTGGGATTG
Reverse Primer: Y4541_R CTGGAGCACAGCCAGACTATC
Reviews

Customers who bought this product also purchased
FGC16217
FGC16217
C Superclade Panel
C Superclade Panel
F3770
F3770
ZQ31
ZQ31
F3918
F3918
BY183180
BY183180
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies