Top » Catalog » SNPs » A14668

$17.50

A14668
[A14668]

A14668
HG19 Position: ChrY:18641959..18641959
Ancestral: T
Derived: C
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z253 > L1066 > S23267
Forward Primer: A14668_F CCACCTGAAAAGACCACCTC
Reverse Primer: A14668_R TGGTGGGAGTTCTCATCCTC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies