Top » Catalog » SNPs » M184

$18.00

M184
[M184]

M184
hg38 Position: ChrY:12786229..12786229
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: T
Comments: Dffryexon23
Forward Primer: M184_F TTTCCTTTCTGTCTGCAGTGG
Reverse Primer: M184_R TTTTGCAAAGGCAAAAACC
Reviews

Customers who bought this product also purchased
CTS2886
CTS2886
Z834
Z834
M4670
M4670
FGC35964
FGC35964
M172
M172
CTS2754
CTS2754
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies