Top » Catalog » SNPs » M184

$18.00

M184
[M184]

M184
hg38 Position: ChrY:12786229..12786229
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: T
Comments: Dffryexon23
Forward Primer: M184_F TTTCCTTTCTGTCTGCAGTGG
Reverse Primer: M184_R TTTTGCAAAGGCAAAAACC
Reviews

Customers who bought this product also purchased
L335
L335
Z834
Z834
M172
M172
M4689
M4689
P77
P77
M269
M269
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L1321
1 x A9411
1 x BY38006
$54.00
Haplogroup Info
Other products
Currencies