Top » Catalog » SNPs » M184

$18.00

M184
[M184]

M184
hg38 Position: ChrY:12786229..12786229
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: T
Comments: Dffryexon23
Forward Primer: M184_F TTTCCTTTCTGTCTGCAGTGG
Reverse Primer: M184_R TTTTGCAAAGGCAAAAACC
Reviews

Customers who bought this product also purchased
M172
M172
P77
P77
L145
L145
Y112765
Y112765
M269
M269
Z29764
Z29764
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies