Top » Catalog » SNPs » M184

$18.00

M184
[M184]

M184
hg38 Position: ChrY:12786229..12786229
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: T
Comments: Dffryexon23
Forward Primer: M184_F TTTCCTTTCTGTCTGCAGTGG
Reverse Primer: M184_R TTTTGCAAAGGCAAAAACC
Reviews

Customers who bought this product also purchased
Z1704
Z1704
CTS9387
CTS9387
M4689
M4689
Z22636
Z22636
Y94997
Y94997
L335
L335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies