Top » Catalog » SNPs » HU214

$18.00

HU214
[HU214]

HU214
hg38 Position: ChrY:19062326..19062326
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU214_F ATGTGGATCGGTCTGAGGAG
Reverse Primer: HU214_R TTCTCAAACGGTGTGATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies