Top » Catalog » SNPs » HU219

$18.00

HU219
[HU219]

HU219
hg38 Position: ChrY:19868607..19868607
Ancestral: A
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU219_F AAATTGCCAACCCAGAAAAC
Reverse Primer: HU219_R CAGCTAGCCAGTGAGACTCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies