Top » Catalog » SNPs » A15855

$18.00

A15855
[A15855]

A15855
hg38 Position: ChrY:15521722..15521722
Ancestral: T
Derived: G
Reference: Gregory Miller (2017)
ISOGG Haplogroup: E1b1b
Comments: Below M84-_Y5441-_Y5427-_Y14899-_Y14891-_Y16781-_Y18621
Forward Primer: A15855v2_F CAATCTGGGTGCTAGAGTAAGACTTC
Reverse Primer: A15855v2_R CCAGGATGGTCTTGGTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies