Top » Catalog » SNPs » CTS6901

$19.00

CTS6901
[CTS6901]

CTS6901
hg38 Position: ChrY:15067347..15067347
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a1a1b2b2b1a1a1c
Comments: Below CTS9882
Forward Primer: CTS6901_F TGTCTTCATTTCCCCTCACC
Reverse Primer: CTS6901_R AGAGGGCAGGGTGTAAAAGG
Reviews

Customers who bought this product also purchased
M96
M96
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
CTS1267
CTS1267
CTS12031
CTS12031
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies