Top » Catalog » SNPs » FGC44917

$18.00

FGC44917
[FGC44917]

FGC44917
hg38 Position: ChrY:2888607..2888607
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Aka Y20902
Forward Primer: FGC44917_F ATTGGTGGTCAGATGCTTCC
Reverse Primer: FGC44917_R CTCAGCAAGCCTTTGTTTCC
Reviews

Customers who bought this product also purchased
FGC1696
FGC1696
BY16791
BY16791
BY8
BY8
BY4
BY4
FGC4415
FGC4415
ZS9318
ZS9318
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies