Top » Catalog » SNPs » FGC44917

$18.00

FGC44917
[FGC44917]

FGC44917
HG19 Position: ChrY:2888607..2888607
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Aka Y20902
Forward Primer: FGC44917_F ATTGGTGGTCAGATGCTTCC
Reverse Primer: FGC44917_R CTCAGCAAGCCTTTGTTTCC
Reviews

Customers who bought this product also purchased
CTS6835
CTS6835
ZS5000
ZS5000
FGC44938
FGC44938
ZS9615
ZS9615
FGC2
FGC2
FGC54410
FGC54410
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies