Top » Catalog » SNPs » M102

$18.00

M102
[M102]

M102
hg38 Position: ChrY:19764226..19764226
Ancestral: G
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2b
Comments: B9.101
Forward Primer: M102_F AAACTGGGACACTTGTAATGAAT
Reverse Primer: M102_R GTTTTTTGAGTCCTTGTTTATTCTT
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies