Top » Catalog » SNPs » S9378

$18.00

S9378
[S9378]

S9378
hg38 Position: ChrY:6850903..6850903
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: N1a1a1a1a1a1a4~
Comments: Below L550.
Forward Primer: S9378_F CCTCAGAGGGGTGAACTGAG
Reverse Primer: S9378_R TGTGCTGTGGAAACTTGGAC
Reviews

Customers who bought this product also purchased
N1a-VL29 Panel
N1a-VL29 Panel
Y4342
Y4342
Y9455
Y9455
Z1936
Z1936
L1025
L1025
CTS337
CTS337
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies