Top » Catalog » SNPs » S9378

$18.00

S9378
[S9378]

S9378
hg38 Position: ChrY:6850903..6850903
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: N1a1a1a1a1a1a4~
Comments: Below L550.
Forward Primer: S9378_F CCTCAGAGGGGTGAACTGAG
Reverse Primer: S9378_R TGTGCTGTGGAAACTTGGAC
Reviews

Customers who bought this product also purchased
A18233
A18233
A18225
A18225
A9856
A9856
BY21954
BY21954
BY21948
BY21948
Y7795
Y7795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies