Top » Catalog » SNPs » HU230

$19.00

HU230
[HU230]

HU230
hg38 Position: ChrY:19871998..19871998
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC4492
Forward Primer: HU230_F TGTGCTAAATAACAAATCTGGGAAAG
Reverse Primer: HU230_R TGATTAGTGATACTTGAAGCAAATTAAGC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4493
FGC4493
FGC5427
FGC5427
Y97574
Y97574
FGC45019
FGC45019
M96
M96
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies