Top » Catalog » SNPs » A15865

$16.00

A15865
[A15865]

A15865
HG19 Position: ChrY:16132594..16132594
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a1a
Comments: .
Forward Primer: A15865_F GTTCTCCACAGAACCAGTACGAATAG
Reverse Primer: A15865_R CCCGTCCTACTCAGTTCTCATTC
Reviews

Customers who bought this product also purchased
A15871
A15871
DYS390
DYS390
A15869
A15869
YSEQ-Alpha
YSEQ-Alpha
A15868
A15868
Whole Genome Sequence (15x)
Whole Genome Sequence (15x)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies