Top » Catalog » SNPs » A15865

$18.00

A15865
[A15865]

A15865
hg38 Position: ChrY:14020714..14020714
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a1a
Comments: .
Forward Primer: A15865_F GTTCTCCACAGAACCAGTACGAATAG
Reverse Primer: A15865_R CCCGTCCTACTCAGTTCTCATTC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
A15868
A15868
Whole Genome Sequence
Whole Genome Sequence
A15864
A15864
A15862
A15862
S27575
S27575
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies