Top » Catalog » SNPs » S24464

$18.00

S24464
[S24464]

S24464
hg38 Position: ChrY:20438012..20438012
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: T1a2b1
Comments: Below L446
Forward Primer: S24464_F GGGGAGATGGAAATATTTACTGG
Reverse Primer: S24464_R GGTTAGGAAGAAGATGGAAAAAGG
Reviews

Customers who bought this product also purchased
Y144975
Y144975
Y144958
Y144958
FGC47681
FGC47681
FGC47689
FGC47689
Y144967
Y144967
FGC23029
FGC23029
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies